VR122 pETv2 10His-pG-Tn5 (E54K, L372P)
(Plasmid #198467)

• Purpose: E. coli protein expression plasmid encoding hyperactive Tn5 transposase fused to protein G, in DH5α cloning strain.
• Depositing Lab: Viviana Risca
• Publication: Soroczynski et al bioRxiv 2024.07.11.602973

Backbone

• Vector backbone: pETv2
• Backbone size w/o insert (bp): 5234
• Total vector size (bp): 6986
• Modifications to backbone: Derived from pET28a, modified according to P. J. Shilling et al. 2020
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 10His-pG-Tn5 (E54K, L372P)
• Alt name: Tn5
• Alt name: OpenTn5
• Species: Synthetic
• Insert Size (bp): 1752
• Mutation: E54K, L372P
• Promoter: Consensus φ10 T7 Promoter
• Tag / Fusion Protein:
  • 10His-pG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • VR122 pETv2 10His-pG-Tn5 (E54K, L372P).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2024.07.11.602973v1 for bioRxiv preprint.