Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRISPR Human CASP9 -2
(Plasmid #198420)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198420 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    GeneArt CRISPR Nuclease OFP Vector Linearized
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 9219
  • Total vector size (bp) 9239
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human CASP9 Specific gRNA
  • Alt name
    CASP-9; ICE-LAP6; Mch6; APAF-3
  • gRNA/shRNA sequence
    ACCAGAGATTCGCAAACCAG
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001229
  • Entrez Gene
    CASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
  • Promoter U6; CMV
  • Tag / Fusion Protein
    • Cas9/Orange Fluorescent Protein Reporter (C terminal on backbone)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR Human CASP9 -2 was a gift from Hannah Rabinowich (Addgene plasmid # 198420 ; http://n2t.net/addgene:198420 ; RRID:Addgene_198420)
  • For your References section:

    Involvement of CASP9 (caspase 9) in IGF2R/CI-MPR endosomal transport. Han J, Goldstein LA, Hou W, Watkins SC, Rabinowich H. Autophagy. 2021 Jun;17(6):1393-1409. doi: 10.1080/15548627.2020.1761742. Epub 2020 May 25. 10.1080/15548627.2020.1761742 PubMed 32397873