pCRISPR Human CASP9 -1
(Plasmid #198419)

• Purpose: Expresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter Protein
• Depositing Lab: Hannah Rabinowich
• Publication: Han et al Autophagy. 2021 Jun;17(6):1393-1409. doi: 10.1080/15548627.2020.1761742. Epub 2020 May 25.

Backbone

• Vector backbone: GeneArt CRISPR Nuclease OFP Vector Linearized
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 9219
• Total vector size (bp): 9239
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human CASP9 Specific gRNA
• Alt name: CASP-9; ICE-LAP6; Mch6; APAF-3
• gRNA/shRNA sequence: ACACCCAGACCAGTGGACAT
• Species: H. sapiens (human)
• GenBank ID: NM_001229
• Entrez Gene: CASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
• Promoter: U6; CMV
• Tag / Fusion Protein:
  • Cas9/Orange Fluorescent Protein Reporter (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGACTATCATATGCTTACCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry