pRS316-OsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
(Plasmid
#198417)
-
PurposeExpresses both OsTIR1F74A and mAID-Nb(VHHGFP4) under the control of ADH1 promoter in budding yeast
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS316
-
Backbone manufacturer4887
- Total vector size (bp) 7927
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
-
Insert Size (bp)2358
- Promoter ADH1 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TATACAACTAGTACCATGACATACTTTCCTG
- 3′ sequencing primer CCGCGGTGGCGGCCGCTTAgctgctaacggtaac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.12.12.520189v1 for bioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS316-OsTIR1F74A-T2A-mAID-Nb (VHHGFP4) was a gift from Takumi Kamura (Addgene plasmid # 198417 ; http://n2t.net/addgene:198417 ; RRID:Addgene_198417) -
For your References section:
Development of AlissAID system targeting GFP or mCherry fusion protein. Ogawa Y, Nishimura K, Obara K, Kamura T. PLoS Genet. 2023 Jun 14;19(6):e1010731. doi: 10.1371/journal.pgen.1010731. eCollection 2023 Jun. 10.1371/journal.pgen.1010731 PubMed 37315088