p-mCherry2-sgMUC4
(Plasmid #198399)

• Purpose: Expresses a guide RNA against a repetitive locus found in the MUC4 gene of human chromosome 3, with mCherry2 reporter
• Depositing Lab: Sarah McClelland
• Publication: Tovini et al EMBO J. 2023 May 15;42(10):e111587. doi: 10.15252/embj.2022111587. Epub 2023 Apr 17.

Backbone

• Vector backbone: pmCherry-sgRNA (empty)
• Backbone manufacturer: Addgene 198330
• Backbone size w/o insert (bp): 5258
• Total vector size (bp): 5133
• Modifications to backbone: Insertion of sgMUC4
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MUC4 sgRNA
• gRNA/shRNA sequence: GGCGTGACCTGTGGATGCTG
• Species: H. sapiens (human)
• Insert Size (bp): 25
• Entrez Gene: MUC4 (a.k.a. ASGP, HSA276359, MUC-4)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (unknown if destroyed)
• 5′ sequencing primer: gcttaccgtaacttgaaagt

Resource Information

• Supplemental Documents:
  • pSMC143 - sgMUC4_mCherry.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

MUC4 guide sequence used is from Chen et al., 2013 (/doi.org/10.1016/j.cell.2013.12.001), where it is referred to as MUC4-E3. Target sequence: GGCGTGACCTGTGGATGCTG