Addgene: p-mCherry2-sgMUC4 Skip to main content
Addgene

p-mCherry2-sgMUC4
(Plasmid #198399)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198399 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmCherry-sgRNA (empty)
  • Backbone manufacturer
    Addgene 198330
  • Backbone size w/o insert (bp) 5258
  • Total vector size (bp) 5133
  • Modifications to backbone
    Insertion of sgMUC4
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MUC4 sgRNA
  • gRNA/shRNA sequence
    GGCGTGACCTGTGGATGCTG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    25
  • Entrez Gene
    MUC4 (a.k.a. ASGP, HSA276359, MUC-4)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (unknown if destroyed)
  • 5′ sequencing primer gcttaccgtaacttgaaagt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

MUC4 guide sequence used is from Chen et al., 2013 (/doi.org/10.1016/j.cell.2013.12.001), where it is referred to as MUC4-E3. Target sequence: GGCGTGACCTGTGGATGCTG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-mCherry2-sgMUC4 was a gift from Sarah McClelland (Addgene plasmid # 198399 ; http://n2t.net/addgene:198399 ; RRID:Addgene_198399)
  • For your References section:

    Targeted assembly of ectopic kinetochores to induce chromosome-specific segmental aneuploidies. Tovini L, Johnson SC, Guscott MA, Andersen AM, Spierings DCJ, Wardenaar R, Foijer F, McClelland SE. EMBO J. 2023 May 15;42(10):e111587. doi: 10.15252/embj.2022111587. Epub 2023 Apr 17. 10.15252/embj.2022111587 PubMed 37063065