PB-Ef1a-RPS27A-UTR-PP7-WPRE
(Plasmid
#198339)
-
PurposePB plasmid expressing RPS27A with its 3'UTR tagged to PP7 stem loops
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneL50
-
Backbone manufacturerin house
- Backbone size w/o insert (bp) 5792
- Total vector size (bp) 8115
-
Vector typeMammalian Expression ; PiggyBac
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRPS27A-3'UTR-PP7 stem loops x24
-
Alt nameRPS27A-PP7
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2232
- Promoter Ef1a
-
Tag
/ Fusion Protein
- PP7 stem loops (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer AATTGTCAGTGCCCAACAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-Ef1a-RPS27A-UTR-PP7-WPRE was a gift from Michael Ward (Addgene plasmid # 198339 ; http://n2t.net/addgene:198339 ; RRID:Addgene_198339) -
For your References section:
Messenger RNA transport on lysosomal vesicles maintains axonal mitochondrial homeostasis and prevents axonal degeneration. De Pace R, Ghosh S, Ryan VH, Sohn M, Jarnik M, Rezvan Sangsari P, Morgan NY, Dale RK, Ward ME, Bonifacino JS. Nat Neurosci. 2024 Apr 10. doi: 10.1038/s41593-024-01619-1. 10.1038/s41593-024-01619-1 PubMed 38600167