pEGFP-N1-AAGAB
(Plasmid
#198333)
-
PurposeExpresses AAGAB-GFP fusion in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198333 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 4733
- Total vector size (bp) 5676
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAAGAB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)947
-
Entrez GeneAAGAB (a.k.a. p34)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (destroyed during cloning)
- 5′ sequencing primer pEGFP-N forward: 5’ CATTGACGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer pEGFP-N reverse: 5’ GTGGCCGTTTACGTCGCCGTCCAGCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-N1-AAGAB was a gift from Juan Bonifacino (Addgene plasmid # 198333 ; http://n2t.net/addgene:198333 ; RRID:Addgene_198333) -
For your References section:
The adaptor protein chaperone AAGAB stabilizes AP-4 complex subunits. Mattera R, De Pace R, Bonifacino JS. Mol Biol Cell. 2022 Oct 1;33(12):ar109. doi: 10.1091/mbc.E22-05-0177. Epub 2022 Aug 17. 10.1091/mbc.E22-05-0177 PubMed 35976721