Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCI-neo-AP-4 (Myc)3-σ4
(Plasmid #198331)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198331 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCI-neo
  • Backbone size w/o insert (bp) 5474
  • Total vector size (bp) 6018
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AP-4 σ4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    578
  • Mutation
    silent substitution in codon 131
  • Promoter CMV
  • Tag / Fusion Protein
    • triple Myc tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
  • 3′ sequencing primer pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

(Myc)3 tag subcloned between XhoI and EcoRI sites; spacer and AP-4 σ4 subcloned between EcoRI and NotI sites (all sites preserved)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-neo-AP-4 (Myc)3-σ4 was a gift from Juan Bonifacino (Addgene plasmid # 198331 ; http://n2t.net/addgene:198331 ; RRID:Addgene_198331)
  • For your References section:

    The adaptor protein chaperone AAGAB stabilizes AP-4 complex subunits. Mattera R, De Pace R, Bonifacino JS. Mol Biol Cell. 2022 Oct 1;33(12):ar109. doi: 10.1091/mbc.E22-05-0177. Epub 2022 Aug 17. 10.1091/mbc.E22-05-0177 PubMed 35976721