Skip to main content
Addgene

pcDNA3.4_1G11F2-3 light chain
(Plasmid #198254)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198254 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.4
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 6712
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    light chain of monoclonal anti-AMP antibody 1G11F2-3 (mouse kappa)
  • Alt name
    1G11 LC
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    759
  • Promoter CMV
  • Tag / Fusion Protein
    • IL10 signal peptide (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Gene synthesis and cloning was a service of Biointron Biological Inc.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.4_1G11F2-3 light chain was a gift from Aymelt Itzen (Addgene plasmid # 198254 ; http://n2t.net/addgene:198254 ; RRID:Addgene_198254)

  • For your References section:

    Monoclonal Anti-AMP Antibodies Are Sensitive and Valuable Tools for Detecting Patterns of AMPylation. Hopfner D, Fauser J, Kaspers MS, Pett C, Hedberg C, Itzen A. iScience. 2020 Nov 13;23(12):101800. doi: 10.1016/j.isci.2020.101800. eCollection 2020 Dec 18. 10.1016/j.isci.2020.101800 PubMed 33299971
Related items:
Commonly requested with: