Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.4_1G11F2-3 heavy chain
(Plasmid #198253)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198253 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.4
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7429
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    heavy chain of monoclonal anti-AMP antibody 1G11F2-3 (mouse IgG2b)
  • Alt name
    1G11 HC
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1476
  • Promoter CMV
  • Tag / Fusion Protein
    • IL10 signal peptide (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Gene synthesis and cloning was a service of Biointron Biological Inc.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.4_1G11F2-3 heavy chain was a gift from Aymelt Itzen (Addgene plasmid # 198253 ; http://n2t.net/addgene:198253 ; RRID:Addgene_198253)
  • For your References section:

    Monoclonal Anti-AMP Antibodies Are Sensitive and Valuable Tools for Detecting Patterns of AMPylation. Hopfner D, Fauser J, Kaspers MS, Pett C, Hedberg C, Itzen A. iScience. 2020 Nov 13;23(12):101800. doi: 10.1016/j.isci.2020.101800. eCollection 2020 Dec 18. 10.1016/j.isci.2020.101800 PubMed 33299971