pBUE411-GGB
(Plasmid
#198233)
-
PurposeWheat GRF4-GIF1 chimera and pPLTP::BBM cassette in pBUE411
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBUE411
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 23361
-
Vector typePlant Expression, CRISPR ; plant binary vector
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGRF4-GIF1 chimera cassette
-
SpeciesSynthetic; Wheat; Agrobacterium tumefaciens
-
Insert Size (bp)4234
- Promoter Ubiquitin
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgtcaaacactgatagtttCTGCAGGCGCGCTAATTCC
- 3′ sequencing primer tcgtttcccgccttcagtttGAGCTCGGTACC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepPLTP::BBM cassette
-
SpeciesZea mays; Agrobacterium tumefaciens
-
Insert Size (bp)3469
- Promoter maize PLTP
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer GGCGCGCCACGCTGCTACTGCTGCTAC
- 3′ sequencing primer ACTAGTtcggtacccgggGATCTAGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe GRF4-GIF1 chimera was obtained from the laboratory of Jorge Dubcovsky at the University of California Davis and Howard Hughes Medical Institute (Addgene deposit JD553), and is described in the following publication: Debernardi et al Nat Biotechnol. 2020 Oct 12. doi: 10.1038/s41587-020-0703-0.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.09.02.506370v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBUE411-GGB was a gift from Andrea Gallavotti (Addgene plasmid # 198233 ; http://n2t.net/addgene:198233 ; RRID:Addgene_198233)