Skip to main content
Addgene

pAGH10 - RlucFluc minus 1 HIV-1
(Plasmid #198224)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198224 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pIS2
  • Backbone manufacturer
    Addgene 12177
  • Backbone size w/o insert (bp) 3746
  • Total vector size (bp) 5421
  • Modifications to backbone
    Insertion of human-codon optimized Renilla luciferase, -1 HIV sequence, and firefly luciferase
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Renilla luciferase
  • Species
    Renilla reniformis
  • Insert Size (bp)
    933
  • Promoter SV40

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer cactttgcctttctctccac
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Firefly luciferase
  • Species
    Firefly (Photinus pyralis)
  • Insert Size (bp)
    1653
  • Promoter SV40

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer cactttgcctttctctccac
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAGH10 - RlucFluc minus 1 HIV-1 was a gift from Isha Jain (Addgene plasmid # 198224 ; http://n2t.net/addgene:198224 ; RRID:Addgene_198224)

  • For your References section:

    Oxygen toxicity causes cyclic damage by destabilizing specific Fe-S cluster-containing protein complexes. Baik AH, Haribowo AG, Chen X, Queliconi BB, Barrios AM, Garg A, Maishan M, Campos AR, Matthay MA, Jain IH. Mol Cell. 2023 Mar 16;83(6):942-960.e9. doi: 10.1016/j.molcel.2023.02.013. Epub 2023 Mar 8. 10.1016/j.molcel.2023.02.013 PubMed 36893757
Related items: