pJL1-MBP-DQNAT
(Plasmid
#198215)
-
PurposepJL1 plasmid encoding E. coli maltose binding protein (MBP) modified at the C-terminus with 30 amino acids containing one optimal DQNAT sequon followed by a 6x-His tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJL1
- Backbone size w/o insert (bp) 1762
- Total vector size (bp) 2986
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMBP_DQNAT
-
Insert Size (bp)1224
- Promoter T7
-
Tags
/ Fusion Proteins
- 6x His Tag (C terminal on insert)
- DQNAT glycosylation tag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1-MBP-DQNAT was a gift from Michael Jewett (Addgene plasmid # 198215 ; http://n2t.net/addgene:198215 ; RRID:Addgene_198215) -
For your References section:
Improving cell-free glycoprotein synthesis by characterizing and enriching native membrane vesicles. Hershewe JM, Warfel KF, Iyer SM, Peruzzi JA, Sullivan CJ, Roth EW, DeLisa MP, Kamat NP, Jewett MC. Nat Commun. 2021 Apr 22;12(1):2363. doi: 10.1038/s41467-021-22329-3. 10.1038/s41467-021-22329-3 PubMed 33888690