pCAG-EGFP/RFP-miR-Scrint
(Plasmid #19821)

• Depositing Lab: Zuoshang Xu
• Publication: Qiu et al BMC Biotechnol. 2008 . 8():77.

Backbone

• Vector backbone: pCAG-EGFP/RFP-int
• Backbone size w/o insert (bp): 8200
• Vector type: Mammalian Expression, RNAi, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Scrambled miRNA
• Insert Size (bp): 400

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AsiSI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: GCTGGACATCACCTCCCACAACG
• 3′ sequencing primer: ACAGGAGGTGGGGAGCAGGAGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A fragment of ~400 bases surrounding the miRNA insertion site was amplified from the first intron of the vector pUbC-miRNA-EGFP [36] with primers 5'-GCAATGACGCGATCGCTAATGCGGGAAAGCTCTTATTCGGGT-3' (forward) and 5'-AAGGCATGACGCGTTGTTGCGGCCGCCAGAGGTCCGGCGCCTGT-3' (reverse).

miR-Scr:
GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC