mVenus-IQ6 R6A
(Plasmid
#198202)
-
PurposeFRET acceptor: Mutated IQ6 domain of Moysin Va tagged with N-terminal mVenus (lower binding affinity)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198202 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMYO5A IQ domain
-
SpeciesM. musculus (mouse)
-
MutationR6A
-
GenBank IDNM_010864.2
-
Entrez GeneMyo5a (a.k.a. 9630007J19Rik, Dbv, MVa, Myo5, MyoVA, Sev-1, d, d-120J, flail, flr)
-
Tag
/ Fusion Protein
- mVenus (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site ApaI (unknown if destroyed)
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mVenus-IQ6 R6A was a gift from Christian Wahl-Schott (Addgene plasmid # 198202 ; http://n2t.net/addgene:198202 ; RRID:Addgene_198202) -
For your References section:
Protocol for deriving proximity, affinity, and stoichiometry of protein interactions using image-based quantitative two-hybrid FRET. Feldmann C, Schanzler M, Ben-Johny M, Wahl-Schott C. STAR Protoc. 2023 Jul 28;4(3):102459. doi: 10.1016/j.xpro.2023.102459. 10.1016/j.xpro.2023.102459 PubMed 37516972