Dimer 42 AA
(Plasmid
#198198)
-
PurposeFRET calibration: Dimer construct consisting of mTurquoise2 and mVenus with a 42AA linker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1+
- Backbone size w/o insert (bp) 5348
- Total vector size (bp) 6911
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemVenus-42AA-mTurquoise2
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dimer 42 AA was a gift from Christian Wahl-Schott (Addgene plasmid # 198198 ; http://n2t.net/addgene:198198 ; RRID:Addgene_198198) -
For your References section:
Protocol for deriving proximity, affinity, and stoichiometry of protein interactions using image-based quantitative two-hybrid FRET. Feldmann C, Schanzler M, Ben-Johny M, Wahl-Schott C. STAR Protoc. 2023 Jul 28;4(3):102459. doi: 10.1016/j.xpro.2023.102459. 10.1016/j.xpro.2023.102459 PubMed 37516972