Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCI-neo-μ4-(HA)3
(Plasmid #198180)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198180 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCI-neo
  • Backbone size w/o insert (bp) 5474
  • Total vector size (bp) 6932
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AP-4 μ4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1480
  • Promoter CMV
  • Tag / Fusion Protein
    • triple HA tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
  • 3′ sequencing primer pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

μ4 + linker + HA tag subcloned between EcoRI and SalI sites, double HA tag subcloned between SalI and NotI sites

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-neo-μ4-(HA)3 was a gift from Juan Bonifacino (Addgene plasmid # 198180 ; http://n2t.net/addgene:198180 ; RRID:Addgene_198180)
  • For your References section:

    Co-assembly of viral envelope glycoproteins regulates their polarized sorting in neurons. Mattera R, Farias GG, Mardones GA, Bonifacino JS. PLoS Pathog. 2014 May 15;10(5):e1004107. doi: 10.1371/journal.ppat.1004107. eCollection 2014 May. 10.1371/journal.ppat.1004107 PubMed 24831812
Commonly requested with: