pAAV-CMV-iRFP713(V256C)-P2A-EGFP
(Plasmid #198071)

• Purpose: The AAV vector for iRFP713(V256C) and EGFP
• Depositing Lab: Michiyuki Matsuda
• Publication: Plasmids for KOBACHI mice project (unpublished)

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4449
• Total vector size (bp): 6159
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: iRFP713(V256C)
• Species: Synthetic
• Insert Size (bp): 1710
• Mutation: V256C mutation
• Promoter: CMV
• Tag / Fusion Protein:
  • P2A-EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TGGTGATGCGGTTTTGGCAGTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr. Vladislav Verkhusha (Addgene plasmid # 45468: pNLS-iRFP713)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry