pAAV-CMV-iRFP713(V256C)-P2A-EGFP
(Plasmid
#198071)
-
PurposeThe AAV vector for iRFP713(V256C) and EGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198071 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4449
- Total vector size (bp) 6159
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiRFP713(V256C)
-
SpeciesSynthetic
-
Insert Size (bp)1710
-
MutationV256C mutation
- Promoter CMV
-
Tag
/ Fusion Protein
- P2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TGGTGATGCGGTTTTGGCAGTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Vladislav Verkhusha (Addgene plasmid # 45468: pNLS-iRFP713)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-iRFP713(V256C)-P2A-EGFP was a gift from Michiyuki Matsuda (Addgene plasmid # 198071 ; http://n2t.net/addgene:198071 ; RRID:Addgene_198071)
