pCAGGS-iRFP713(C15S/V256C)-P2A-mCherry
(Plasmid
#198069)
-
PurposeMammalian expression of iRFP713(C15S/V256C) and EGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4425
- Total vector size (bp) 6162
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiRFP713(C15S/V256C)
-
SpeciesSynthetic
-
Insert Size (bp)1737
-
MutationC15S/V256C mutation
- Promoter CAG
-
Tag
/ Fusion Protein
- P2A-mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CTAGAGCCTCTGCTAACCATGTTCATGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Vladislav Verkhusha (Addgene plasmid # 45468: pNLS-iRFP713)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-iRFP713(C15S/V256C)-P2A-mCherry was a gift from Michiyuki Matsuda (Addgene plasmid # 198069 ; http://n2t.net/addgene:198069 ; RRID:Addgene_198069)