H2B CFP
(Plasmid
#198059)
-
PurposemCerulean fused to human H2B protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCS2+8
- Backbone size w/o insert (bp) 4137
- Total vector size (bp) 5249
-
Vector typeSynthetic Biology ; sea urchin, mammal, zebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B
-
Alt nameHuman Histone H2B
-
SpeciesH. sapiens (human); A. victoria
-
Insert Size (bp)1116
- Promoter sp6
-
Tag
/ Fusion Protein
- mCerulean (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGACGTAAATGGGCGGTAGG
- 3′ sequencing primer GTCATAGCTGTTTCCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTwist Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H2B CFP was a gift from Amro Hamdoun (Addgene plasmid # 198059 ; http://n2t.net/addgene:198059 ; RRID:Addgene_198059)