Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Membrane mNeonGreen
(Plasmid #198057)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198057 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCS2+8
  • Backbone size w/o insert (bp) 4137
  • Total vector size (bp) 4961
  • Vector type
    Synthetic Biology ; sea urchin, mammal, zebrafish

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LCK membrane mNeonGreen
  • Alt name
    LCK proto-oncogene, Src family tyrosine kinase
  • Species
    H. sapiens (human); A.victoria
  • Insert Size (bp)
    828
  • Mutation
    Tandem repeat of N-terminal LCK membrane targeting sequence (MGCIKSKRKDNLNDDEAAMGCIKSKRKDNLNDDEAPVAT) fused to mNeonGreen
  • GenBank ID
  • Entrez Gene
    LCK (a.k.a. IMD22, LSK, YT16, p56lck, pp58lck)
  • Promoter sp6
  • Tag / Fusion Protein
    • mNeonGreen (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TGACGTAAATGGGCGGTAGG
  • 3′ sequencing primer GTCATAGCTGTTTCCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Twist Bioscience

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Membrane mNeonGreen was a gift from Amro Hamdoun (Addgene plasmid # 198057 ; http://n2t.net/addgene:198057 ; RRID:Addgene_198057)