pL1P4 ZmUbiP:GRF-GIF:NosT
(Plasmid
#198048)
-
PurposeMoClo Golden Gate Level 1 Position 4. Overexpression cassette of Growth-Regulating Factor 4 (GRF4) plus GRF-Interacting Factor 1 (GRF4-GIF1). Improves in vitro wheat regeneration and transformation.
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198048 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepICH47761 AddGene #48003
-
Backbone manufacturerSylvestre Marillonnet
- Backbone size w/o insert (bp) 4348
- Total vector size (bp) 8543
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZmUbiP::TaGRF4-GIF1::NosT
-
Alt nameOverexpression Growth-Regulating Factor 4 and cofactor GRF-Interacting Factor 1
-
SpeciesSynthetic
-
Insert Size (bp)4195
- Promoter Zea mays (maize) ubiquitin promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Eco31I (BsaI) (destroyed during cloning)
- 3′ cloning site Eco31I (BsaI) (destroyed during cloning)
- 5′ sequencing primer GAACCCTGTGGTTGGCATGCACATAC
- 3′ sequencing primer CTGGTGGCAGGATATATTGTGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDebernardi JM, Tricoli DM, Ercoli MF, Hayta S, Ronald P, Palatnik JF, Dubcovsky J. Nat Biotechnol 38, 1274–1279 (2020). We acknowledge the researchers at UC Davis and HHMI for the development of GRF4-GIF1 fusion reported in PMID: 33046875.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL1P4 ZmUbiP:GRF-GIF:NosT was a gift from Cristobal Uauy & John Innes Centre - Wheat Transformation and Genome Editing (Addgene plasmid # 198048 ; http://n2t.net/addgene:198048 ; RRID:Addgene_198048)