pIBA2-IntHA453-SpyTag
(Plasmid #198039)

• Purpose: Expression plasmid for producing SpyTagged intimin
• Depositing Lab: Jack Leo
• Publication: Duodu et al Methods Mol Biol. 2024;2778:53-63. doi: 10.1007/978-1-0716-3734-0_4.

Backbone

• Vector backbone: pASK-IBA2
• Backbone manufacturer: IBA Lifescience
• Backbone size w/o insert (bp): 2826
• Total vector size (bp): 6007
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: eaeA
• Alt name: intimin
• Species: Escherichia coli
• Insert Size (bp): 2943
• Mutation: double HA tag inserted at position 453; lacks native signal peptide (amino acids 1-39)
• GenBank ID: WP_000627890 E2348C_RS21125
• Promoter: tet
• Tag / Fusion Protein:
  • SpyTag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGTTATTTTACCACTCCCT
• 3′ sequencing primer: CGCAGTAGCGGTAAACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Monika Schuetz, University Clinics Tuebingen, Tuebingen, Germany

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry