Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAGG-GST-TEV-NAP1 (WT)
(Plasmid #198034)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 198034 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAGG
  • Backbone manufacturer
    GenScript
  • Backbone size w/o insert (bp) 4790
  • Total vector size (bp) 7445
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NAP1
  • Alt name
    AZI2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1903
  • GenBank ID
    AY151386
  • Entrez Gene
    AZI2 (a.k.a. AZ2, NAP1, TILP)
  • Tag / Fusion Protein
    • GST-TEV (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gatgatatctgtattctgaatcatgaaa
  • 3′ sequencing primer taattcttataaaggcagttctgatta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGG-GST-TEV-NAP1 (WT) was a gift from Sascha Martens (Addgene plasmid # 198034 ; http://n2t.net/addgene:198034 ; RRID:Addgene_198034)
  • For your References section:

    Unconventional initiation of PINK1/Parkin mitophagy by Optineurin. Nguyen TN, Sawa-Makarska J, Khuu G, Lam WK, Adriaenssens E, Fracchiolla D, Shoebridge S, Bernklau D, Padman BS, Skulsuppaisarn M, Lindblom RSJ, Martens S, Lazarou M. Mol Cell. 2023 May 18;83(10):1693-1709.e9. doi: 10.1016/j.molcel.2023.04.021. 10.1016/j.molcel.2023.04.021 PubMed 37207627