pFastBac-GST-TEV-mCherry-TBK1
(Plasmid
#198033)
-
PurposeUsed for the expression and purification of mCherry labelled TBK1 (SMC Internal No.: 1675)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac
-
Backbone manufacturerGenScript
- Backbone size w/o insert (bp) 4776
- Total vector size (bp) 8772
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTBK1
-
Alt nameNF-kappa-B-activating kinase
-
Alt nameT2K
-
Alt nameNAK
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3639
-
MutationE696K
-
GenBank IDAF191838
-
Entrez GeneTBK1 (a.k.a. FTDALS4, IIAE8, NAK, T2K)
-
Tags
/ Fusion Proteins
- GST-TEV (N terminal on insert)
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TACGGTGCTACCGTGGACCT
- 3′ sequencing primer CCTCTAGTACTTCTCGACAAGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac-GST-TEV-mCherry-TBK1 was a gift from Sascha Martens (Addgene plasmid # 198033 ; http://n2t.net/addgene:198033 ; RRID:Addgene_198033) -
For your References section:
Unconventional initiation of PINK1/Parkin mitophagy by Optineurin. Nguyen TN, Sawa-Makarska J, Khuu G, Lam WK, Adriaenssens E, Fracchiolla D, Shoebridge S, Bernklau D, Padman BS, Skulsuppaisarn M, Lindblom RSJ, Martens S, Lazarou M. Mol Cell. 2023 May 18;83(10):1693-1709.e9. doi: 10.1016/j.molcel.2023.04.021. 10.1016/j.molcel.2023.04.021 PubMed 37207627