Skip to main content
Addgene

pLVX-shRNA2-zsGreen-PGK-puro_scramble shRNA
(Plasmid #197991)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197991 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLVX-shRNA2-zsGreen-PGK-puro
  • Backbone size w/o insert (bp) 8998
  • Total vector size (bp) 9038
  • Modifications to backbone
    The scramble shRNA sequence, as control for knockdown experiments, has been cloned into pLVX-shRNA2-zsGreen-PGK-puro by BamHI-EcoRI cloning site.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    Room Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    scramble shRNA (control)
  • gRNA/shRNA sequence
    CGTATACCCGGAACAAAGGTCAAGAGCCTTTGTTCCGGGTATACGTTTTTT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    63
  • Mutation
    15q11.2 deletion
  • Tag / Fusion Protein
    • zsGreen1 (C terminal on backbone)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-shRNA2-zsGreen-PGK-puro_scramble shRNA was a gift from Bo Wang (Addgene plasmid # 197991 ; http://n2t.net/addgene:197991 ; RRID:Addgene_197991)

  • For your References section:

    Copy number variation-associated lncRNAs may contribute to the etiologies of congenital heart disease. Lu Y, Fang Q, Qi M, Li X, Zhang X, Lin Y, Xiang Y, Fu Q, Wang B. Commun Biol. 2023 Feb 17;6(1):189. doi: 10.1038/s42003-023-04565-z. 10.1038/s42003-023-04565-z PubMed 36806749
Related items: