pC1300_pUB10_pco-nCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
(Plasmid
#197980)
-
PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by CmYLCVp, flanked by ribozymes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197980 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCambia1300
- Total vector size (bp) 15013
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namepco-nCasphi-2
-
Alt nameArabidopsis codon optimized nCasphi-2
-
SpeciesSynthetic
-
Insert Size (bp)2460
- Promoter pUBQ10
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGATTTCTATCTAGATCTGGTGTTAGT
- 3′ sequencing primer CTGATGCATTGAACTTGACGAACGT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAtPDS3 gRNA10
-
Alt nameAtPDS3 guide RNA10 driven by the CmYLCV promoter and flanked by ribozymes
-
SpeciesSynthetic
- Promoter CmYLCVp
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGCAGACATACTGTCCCACA
- 3′ sequencing primer ACGTTGTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1300_pUB10_pco-nCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10 was a gift from Steven Jacobsen (Addgene plasmid # 197980 ; http://n2t.net/addgene:197980 ; RRID:Addgene_197980) -
For your References section:
Genome editing in plants using the compact editor CasPhi. Li Z, Zhong Z, Wu Z, Pausch P, Al-Shayeb B, Amerasekera J, Doudna JA, Jacobsen SE. Proc Natl Acad Sci U S A. 2023 Jan 24;120(4):e2216822120. doi: 10.1073/pnas.2216822120. Epub 2023 Jan 18. 10.1073/pnas.2216822120 PubMed 36652483