Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-EF1α-Flex/3'USS-mCherry(ATG full mut)
(Plasmid #197893)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197893 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-MCS
  • Total vector size (bp) 6906
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stbl3 and DH5alpha are also suitable growth strains.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Species
    Discosoma sp.
  • Insert Size (bp)
    711
  • Mutation
    N/A
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atggagtttccccacactga
  • 3′ sequencing primer cagcgtatccacatagcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1α-Flex/3'USS-mCherry(ATG full mut) was a gift from Kazuto Kobayashi (Addgene plasmid # 197893 ; http://n2t.net/addgene:197893 ; RRID:Addgene_197893)
  • For your References section:

    Highly selective transgene expression through the flip-excision switch system by using a unilateral spacer sequence. Matsushita N, Kato S, Nishizawa K, Sugawara M, Takeuchi K, Miyasaka Y, Mashimo T, Kobayashi K. Cell Rep Methods. 2023 Jan 18;3(2):100393. doi: 10.1016/j.crmeth.2022.100393. eCollection 2023 Feb 27. 10.1016/j.crmeth.2022.100393 PubMed 36936079