pAAV-EF1α-Flex/3'USS-hM4D/2A/GFP(ATG mut)
(Plasmid
#197892)
-
PurposeCan be used to generate AAV virus that will express hM4D/2A/GFP in the presence of Cre and the leakage expression is significantly reduced without Cre
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197892 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-MCS
- Total vector size (bp) 8415
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3 and DH5alpha are also suitable growth strains.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehM4D/2A/GFP
-
SpeciesHomo sapiens/Thosea asigna virus/Aequorea victoria
-
Insert Size (bp)2220
-
MutationN/A
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atggagtttccccacactga
- 3′ sequencing primer cagcgtatccacatagcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1α-Flex/3'USS-hM4D/2A/GFP(ATG mut) was a gift from Kazuto Kobayashi (Addgene plasmid # 197892 ; http://n2t.net/addgene:197892 ; RRID:Addgene_197892) -
For your References section:
Highly selective transgene expression through the flip-excision switch system by using a unilateral spacer sequence. Matsushita N, Kato S, Nishizawa K, Sugawara M, Takeuchi K, Miyasaka Y, Mashimo T, Kobayashi K. Cell Rep Methods. 2023 Jan 18;3(2):100393. doi: 10.1016/j.crmeth.2022.100393. eCollection 2023 Feb 27. 10.1016/j.crmeth.2022.100393 PubMed 36936079