pLV-EF1a-AcGFP-P2A-hBRD2
(Plasmid #197880)

• Purpose: study roles of human BET proteins in human pluripotency reprogramming
• Depositing Lab: Kejin Hu
• Publication: Hossain et al iScience. 2022 Dec 28;26(1):105889. doi: 10.1016/j.isci.2022.105889. eCollection 2023 Jan 20.

Backbone

• Vector backbone: pLVH-EF1a-GFP-P2A
• Backbone size w/o insert (bp): 8317
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BRD2
• Alt name: RING3
• Alt name: KIAA9001
• Species: H. sapiens (human)
• Insert Size (bp): 2406
• GenBank ID: NM_005104
• Entrez Gene: BRD2 (a.k.a. BRD2-IT1, D6S113E, FSH, FSHRG1, FSRG1, NAT, O27.1.1, RING3, RNF3)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (destroyed during cloning)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: cacggcatggatgagctgta
• 3′ sequencing primer: ccagtcaatctttcacaaat

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry