Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV-EF1a-AcGFP-P2A-hBRD2
(Plasmid #197880)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197880 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLVH-EF1a-GFP-P2A
  • Backbone size w/o insert (bp) 8317
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BRD2
  • Alt name
    RING3
  • Alt name
    KIAA9001
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2406
  • GenBank ID
    NM_005104
  • Entrez Gene
    BRD2 (a.k.a. BRD2-IT1, D6S113E, FSH, FSHRG1, FSRG1, NAT, O27.1.1, RING3, RNF3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer cacggcatggatgagctgta
  • 3′ sequencing primer ccagtcaatctttcacaaat
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-EF1a-AcGFP-P2A-hBRD2 was a gift from Kejin Hu (Addgene plasmid # 197880 ; http://n2t.net/addgene:197880 ; RRID:Addgene_197880)
  • For your References section:

    Attenuating iPSC reprogramming stress with dominant-negative BET peptides. Hossain ME, Cevallos RR, Zhang R, Hu K. iScience. 2022 Dec 28;26(1):105889. doi: 10.1016/j.isci.2022.105889. eCollection 2023 Jan 20. 10.1016/j.isci.2022.105889 PubMed 36691621