4A3.PBAD-repL(AT2).J23115-gfp
(Plasmid
#197873)
-
PurposeArabinose induced expression of repL(AT2) gene, which triggers DNA replication in trans, weak level of constitutive GFP expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSC101 (4A3)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepart kilA/repL(AT2)
-
SpeciesBacteriophage P1 (E. coli P1 lysogen EMG16)
-
Insert Size (bp)899
- Promoter PBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cataagattagcggatcctacctgac
- 3′ sequencing primer gttaaagctgttctcgctaagacattg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
4A3.PBAD-repL(AT2).J23115-gfp was a gift from Baojun Wang (Addgene plasmid # 197873 ; http://n2t.net/addgene:197873 ; RRID:Addgene_197873) -
For your References section:
An adenine/thymidine-rich region is integral to RepL-mediated DNA replication. Huan YW, Brown R, Wang B. Front Microbiol. 2023 Feb 9;14:1095671. doi: 10.3389/fmicb.2023.1095671. eCollection 2023. 10.3389/fmicb.2023.1095671 PubMed 36846746