Skip to main content
Addgene

4A3.PBAD-repL(WT).J23115-gfp
(Plasmid #197872)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197872 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSC101 (4A3)
  • Backbone size w/o insert (bp) 3197
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    part kilA/repL
  • Species
    Bacteriophage P1 (E. coli P1 lysogen EMG16)
  • Insert Size (bp)
    899
  • Mutation
    contains only the 24 bp of 3'-end of kilA gene sequence
  • Promoter PBAD

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cataagattagcggatcctac
  • 3′ sequencing primer gatgacgtggcaataaagaataag
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    gfp
  • Insert Size (bp)
    717
  • Promoter Bba_J23115

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTAGAgctagcattgtaccaagg
  • 3′ sequencing primer CATGGAACAGGTAGTTTTCCAG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    4A3.PBAD-repL(WT).J23115-gfp was a gift from Baojun Wang (Addgene plasmid # 197872 ; http://n2t.net/addgene:197872 ; RRID:Addgene_197872)

  • For your References section:

    An adenine/thymidine-rich region is integral to RepL-mediated DNA replication. Huan YW, Brown R, Wang B. Front Microbiol. 2023 Feb 9;14:1095671. doi: 10.3389/fmicb.2023.1095671. eCollection 2023. 10.3389/fmicb.2023.1095671 PubMed 36846746
Related items: