pminiT-Halo-MED1 donor
(Plasmid #197868)

• Purpose: Donor plasmid used for building Halo-MED1 knock-in mESCs
• Depositing Lab: James Zhe Liu
• Publication: Dong et al bioRxiv 2022.10.26.513917

Backbone

• Vector backbone: pminiT
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 2525
• Total vector size (bp): 4308
• Vector type: Mouse Targeting

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CRSP210
• Alt name: PBP; Pparbp; TRIP-2
• Species: M. musculus (mouse)
• GenBank ID: NM_001347384.1 NP_001334313.1
• Entrez Gene: Med1 (a.k.a. CRSP210, DRIP205, PBP, Pparbp, TRAP220, TRIP-2, l11Jus15)
• Promoter: NA
• Tag / Fusion Protein:
  • Halotag (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATAAAGAGGAACGCAGAATG
• 3′ sequencing primer: CCCACCTCCTCTCTCGG

Resource Information

• Supplemental Documents:
  • pminiT-Halo-MED1.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.10.26.513917v1 for bioRxiv preprint.