Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pminiT-MED6-mEmerald donor
(Plasmid #197865)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197865 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pminiT
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 2525
  • Total vector size (bp) 4233
  • Modifications to backbone
    add Med6 homology arms around C terminal with a mEmerald coding sequence
  • Vector type
    Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Med6
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2200
  • GenBank ID
    NM_001347384.1 NP_001334313.1
  • Entrez Gene
    Med6 (a.k.a. 1500012F11Rik)
  • Promoter NA
  • Tag / Fusion Protein
    • mEmerald (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATAAAGAGGAACGCAGAATG
  • 3′ sequencing primer CACGGTGCTGAGGTATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.10.26.513917v1 for bioRxiv preprint.

Addgene QC found S228G mutation in mEmerald that does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pminiT-MED6-mEmerald donor was a gift from James Zhe Liu (Addgene plasmid # 197865 ; http://n2t.net/addgene:197865 ; RRID:Addgene_197865)
  • For your References section:

    Spatial organization of the 3D genome encodes gene co-expression programs in single cells. Dong P, Zhang S, Xie L, Wang L, Lemire AL, Lander AD, Chang HY, Liu ZJ. bioRxiv 2022.10.26.513917 10.1101/2022.10.26.513917