pCMV_PACLight1
(Plasmid
#197864)
-
PurposeMammalian expression of PACLight1 biosensor for PACAP (Pituitary Adenylate Cyclase Activating Peptide)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197864 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 3986
- Total vector size (bp) 6176
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePACLight1
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2190
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer aacttgtttattgcagct (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.02.06.579048 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV_PACLight1 was a gift from Tommaso Patriarchi (Addgene plasmid # 197864 ; http://n2t.net/addgene:197864 ; RRID:Addgene_197864) -
For your References section:
Probing PAC1 receptor activation across species with an engineered sensor. Cola RB, Niethammer SN, Rajamannar P, Gresch A, Bhat MA, Assoumou K, Williams ET, Hauck P, Hartrampf N, Benke D, Stoeber M, Levkowitz G, Melzer S, Patriarchi T. eLife. 2024 Aug 15;13:RP96496. doi: 10.7554/eLife.96496. 10.7554/eLife.96496 PubMed 39145773