-
PurposeNon-integrating (episomal) expression of mouse c-Myc
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 19772 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCX
-
Backbone manufacturerJun-ichi Miyazaki
- Backbone size w/o insert (bp) 4778
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namec-Myc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1350
-
Entrez GeneMyc (a.k.a. Myc2, Niard, Nird, bHLHe39)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCGAGCCGCAGCCATTGCCTTTTA
- 3′ sequencing primer TTAGCCAGAAGTCAGATGCTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCX-cMyc was a gift from Shinya Yamanaka (Addgene plasmid # 19772 ; http://n2t.net/addgene:19772 ; RRID:Addgene_19772) -
For your References section:
Generation of mouse induced pluripotent stem cells without viral vectors. Okita K, Nakagawa M, Hyenjong H, Ichisaka T, Yamanaka S. Science. 2008 Nov 7. 322(5903):949-53. 10.1126/science.1164270 PubMed 18845712