pCX-cMyc
(Plasmid #19772)

• Purpose: Non-integrating (episomal) expression of mouse c-Myc
• Depositing Lab: Shinya Yamanaka
• Publication: Okita et al Science. 2008 Nov 7. 322(5903):949-53.

Backbone

• Vector backbone: pCX
• Backbone manufacturer: Jun-ichi Miyazaki
• Backbone size w/o insert (bp): 4778
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: c-Myc
• Species: M. musculus (mouse)
• Insert Size (bp): 1350
• Entrez Gene: Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCGAGCCGCAGCCATTGCCTTTTA
• 3′ sequencing primer: TTAGCCAGAAGTCAGATGCTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.
• Articles Citing this Plasmid:
  • 11 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry