4A3.S'U'
(Plasmid #197676)

• Purpose: Expresses P1 S' tail fibre and U' chaperone
• Depositing Lab: Baojun Wang
• Publication: Huan et al J Mol Biol. 2022 Sep 15;434(21):167829. doi: 10.1016/j.jmb.2022.167829.

Backbone

• Vector backbone: pSC101 (4A3)
• Backbone size w/o insert (bp): 3343
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: S'
• Species: Bacteriophage P1 (E. coli P1 lysogen EMG16)
• Insert Size (bp): 2919
• GenBank ID: N/A N/A
• Promoter: Late S promoter, LPS

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaggcttcacaacattgattag
• 3′ sequencing primer: ttttgttttagggttgccag

Gene/Insert 2

• Gene/Insert name: U'
• Species: Bacteriophage P1 (E. coli P1 lysogen EMG16)
• Insert Size (bp): 532
• GenBank ID: N/A N/A
• Promoter: N/A

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcattaatgggacgtggtataac
• 3′ sequencing primer: ctcgagtgcggccgcaagcttgtcg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry