Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

4A3.SU
(Plasmid #197675)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197675 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSC101 (4A3)
  • Total vector size (bp) 3343
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    S
  • Species
    Bacteriophage P1 (E. coli P1 lysogen EMG16)
  • Insert Size (bp)
    2961
  • GenBank ID
    n/a n/a
  • Promoter Late S promoter, LPS

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cttatcttacaatgaggcttcac
  • 3′ sequencing primer gtctttgggtttcctgacctg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    U
  • Species
    Bacteriophage P1 (E. coli P1 lysogen EMG16)
  • Insert Size (bp)
    528
  • GenBank ID
    n/a n/a
  • Promoter N/A

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aaaatacatcaatggcatat
  • 3′ sequencing primer cggagctcgaattcggatcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    4A3.SU was a gift from Baojun Wang (Addgene plasmid # 197675 ; http://n2t.net/addgene:197675 ; RRID:Addgene_197675)
  • For your References section:

    The Role of O-antigen in P1 Transduction of Shigella flexneri and Escherichia coli with its Alternative S' Tail Fibre. Huan YW, Fa-Arun J, Wang B. J Mol Biol. 2022 Sep 15;434(21):167829. doi: 10.1016/j.jmb.2022.167829. 10.1016/j.jmb.2022.167829 PubMed 36116540
Commonly requested with: