BL21(DE3) ΔserC
(Bacterial strain
#197656)
-
PurposeDerivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine.
-
Depositing Labs
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 197656 | Bacteria in agar stab | 1 | $85 |
Backbone
-
Vector backbonen/a
-
Vector typeThis is a strain, not a plasmid
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)BL21(DE3) ΔserC
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThis strain is a derivative of BL21(DE3) with the serC gene knocked out
-
Speciesn/a
Cloning Information
- Cloning method Unknown
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine.
Primers for verification:
- for serC deletion: CCTCAACGGTTTTACTCATTGCGATG, CGGGCAGATTAATAGTGCCATCGAC
Additional reference: Rogerson et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol. 2015 Jul;11(7):496-503
Please visit https://www.biorxiv.org/content/10.1101/2021.10.22.465468v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BL21(DE3) ΔserC was a gift from Richard Cooley & Ryan Mehl (Addgene plasmid # 197656) -
For your References section:
Autonomous Synthesis of Functional, Permanently Phosphorylated Proteins for Defining the Interactome of Monomeric 14-3-3zeta. Zhu P, Stanisheuski S, Franklin R, Vogel A, Vesely CH, Reardon P, Sluchanko NN, Beckman JS, Karplus PA, Mehl RA, Cooley RB. ACS Cent Sci. 2023 Apr 10;9(4):816-835. doi: 10.1021/acscentsci.3c00191. eCollection 2023 Apr 26. 10.1021/acscentsci.3c00191 PubMed 37122473