Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

B95(DE3) ΔA ΔfabR ΔserB
(Bacterial strain #197655)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 197655 Bacteria in agar stab 1 $85

Backbone

  • Vector backbone
    n/a
  • Vector type
    This is a strain, not a plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    None
  • Growth Temperature
    37°C
  • Growth Strain(s)
    B95(DE3) ΔA ΔfabR ΔserB
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    This strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo
  • Species
    n/a

Cloning Information

  • Cloning method Unknown

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Derivative of BL21(DE3) with no specific assignment of the UAG codon
- 95 endogenous TAG codons mutated to TAA
- RF1 (prfA) deleted and fabR spontaneously mutated
- serB deleted for phosphoserine genetic code expansion expression applications

Primers for verification:
- for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG
- for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG

This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein
- Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest).

Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    B95(DE3) ΔA ΔfabR ΔserB was a gift from Richard Cooley & Ryan Mehl (Addgene plasmid # 197655)
  • For your References section:

    A Highly Versatile Expression System for the Production of Multiply Phosphorylated Proteins. Zhu P, Gafken PR, Mehl RA, Cooley RB. ACS Chem Biol. 2019 Jul 19;14(7):1564-1572. doi: 10.1021/acschembio.9b00307. Epub 2019 Jun 17. 10.1021/acschembio.9b00307 PubMed 31243963