pDule2 - Mj Acd A9
(Plasmid #197652)

• Purpose: E. coli machinery vector for the genetic encoding of acridone at TAG codons using the M. jannaschii Acd-A9 synthetase/tRNA pair
• Depositing Lab: Ryan Mehl
• Publication: Sungwienwong et al Org Biomol Chem. 2017 May 3;15(17):3603-3610. doi: 10.1039/c7ob00582b.

Backbone

• Vector backbone: pDule2
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 6900
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Mj Acd A9 synthetase
• Species: Methanocaldococcus jannaschii
• Insert Size (bp): 921
• Mutation: Y32A, L65D, F108L, Q109E, D158S, L162T
• Promoter: GlnS
• Tag / Fusion Protein:
  • None

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CGTCACTGCGTCTTTTACTG

Gene/Insert 2

• Gene/Insert name: Methanocaldococcus jannaschii tRNA
• Species: Methanocaldococcus jannaschii
• Promoter: lpp

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTCTGTTGCCCGTCTCACTGG

Resource Information

• Supplemental Documents:
  • pDule2-Mj Acd 9.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry