pLenti-hSyn1-mScarlet/CAAX
(Plasmid
#197592)
-
PurposeLentiviral transfer vector for the neuronal expression of membrane-bound mScarlet (good visualization of neuronal processes)
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 8409
- Total vector size (bp) 9207
-
Modifications to backboneHuman Synapsin I gene promoter
-
Vector typeLentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemScarlet-CAAX
-
Insert Size (bp)798
- Promoter hSynI
-
Tag
/ Fusion Protein
- CAAX (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agtcgtgtcgtgcctgag
- 3′ sequencing primer TGTTGCTCCTTTTACGCTATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-hSyn1-mScarlet/CAAX was a gift from Patrik Verstreken (Addgene plasmid # 197592 ; http://n2t.net/addgene:197592 ; RRID:Addgene_197592)
Map uploaded by the depositor.
