Skip to main content
Addgene

pAcBac1-Mb-Fluoro-Phe B5
(Plasmid #197576)

Print

Ordering

This material is available to academics and nonprofits only. Availability may be limited outside the U.S. Please log in for more information.
Item Catalog # Description Quantity Price (USD)
Plasmid 197576 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAcBac1
  • Backbone size w/o insert (bp) 9000
  • Total vector size (bp) 10350
  • Vector type
    Mammalian Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Mb Pyl Fluoro-Phe B5 synthetase
  • Species
    Methanosarcina barkeri
  • Mutation
    N311G, C313A
  • Promoter CMV
  • Tag / Fusion Protein
    • Nuclear export sequence + FLAG (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Pyl-tRNA (4 copies)
  • Species
    Methanosarcina barkeri / Desulfitobacterium hafniens
  • Promoter U6/H1

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAcBac1-Mb-Fluoro-Phe B5 was a gift from Ryan Mehl (Addgene plasmid # 197576 ; http://n2t.net/addgene:197576 ; RRID:Addgene_197576)

  • For your References section:

    Tuning phenylalanine fluorination to assess aromatic contributions to protein function and stability in cells. Galles GD, Infield DT, Clark CJ, Hemshorn ML, Manikandan S, Fazan F, Rasouli A, Tajkhorshid E, Galpin JD, Cooley RB, Mehl RA, Ahern CA. Nat Commun. 2023 Jan 4;14(1):59. doi: 10.1038/s41467-022-35761-w. 10.1038/s41467-022-35761-w PubMed 36599844
Related items:
Commonly requested with: