pALS2-sfGFP 150TAG
(Plasmid #197574)

• Purpose: Fluorescence selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-150TAG and M. alvus Pyl-tRNA(6). p15a origin of replication.
• Depositing Lab: Ryan Mehl
• Publication: Avila-Crump et al ACS Chem Biol. 2022 Dec 16;17(12):3458-3469. doi: 10.1021/acschembio.2c00639. Epub 2022 Nov 16.

Backbone

• Vector backbone: pALS2
• Total vector size (bp): 5513
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: sfGFP 150TAG
• Mutation: N150TAG
• Promoter: araC
• Tag / Fusion Protein:
  • His6 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC

Gene/Insert 2

• Gene/Insert name: M. alvus Pyl-tRNA (6)
• Species: Methanomethylophilus alvus
• Promoter: lpp

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: TTCTGTTGCCCGTCTCACTGG

Resource Information

• Supplemental Documents:
  • pALS2 Ma-tRNApyl - sfGFP 150TAG.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry