Ma-Barnase
(Plasmid #197572)

• Purpose: Negative selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses 2xTAG-codon interrupted barnase gene and M. alvus Pyl-tRNA(6). p15a origin of replication.
• Depositing Lab: Ryan Mehl
• Publication: Avila-Crump et al ACS Chem Biol. 2022 Dec 16;17(12):3458-3469. doi: 10.1021/acschembio.2c00639. Epub 2022 Nov 16.

Backbone

• Vector backbone: Custom
• Total vector size (bp): 4727
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Barnase - 2xTAG
• Species: Bacillus amyloliquefaciens
• Insert Size (bp): 336
• Mutation: 3TAG and 45TAG
• Promoter: araC
• Tag / Fusion Protein:
  • none

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC

Gene/Insert 2

• Gene/Insert name: M. alvus Pyl-tRNA (6)
• Species: Methanomethylophilus alvus
• Insert Size (bp): 69
• Promoter: lpp

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCTGTTCAGCTACTGACGGGG

Resource Information

• Supplemental Documents:
  • Ma barnase.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry