Ma-pREP
(Plasmid #197571)

• Purpose: Positive selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses TAG-codon interrupted chloramphenicol resistance cassette and M. alvus Pyl-tRNA(6). p15a ori
• Depositing Lab: Ryan Mehl
• Publication: Avila-Crump et al ACS Chem Biol. 2022 Dec 16;17(12):3458-3469. doi: 10.1021/acschembio.2c00639. Epub 2022 Nov 16.

Backbone

• Vector backbone: pREP
• Total vector size (bp): 10326
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Chloramphenicol resistance gene - 111TAG
• Insert Size (bp): 660
• Mutation: 111TAG
• Promoter: cat promoter (constitutive)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: cctgttgataccgggaagccc

Gene/Insert 2

• Gene/Insert name: T7 polymerase -TAG
• Insert Size (bp): 2673
• Mutation: 8TAG/112TAG
• Promoter: AraC

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC

Gene/Insert 3

• Gene/Insert name: GFPuv
• Insert Size (bp): 717
• Promoter: T7

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Gene/Insert 4

• Gene/Insert name: M. alvus Pyl-tRNA(6)
• Species: Methanomethylophilus alvus
• Insert Size (bp): 69
• Promoter: lpp (constitutive)

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCATGGCGTTCTGTTGCCC

Resource Information

• Supplemental Documents:
  • Ma pREP (1).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry