-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 19752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLB2
- Backbone size (bp) 10552
-
Vector typeMammalian Expression, Mouse Targeting, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Growth instructionsgrow in stbl3 cells at 30oC
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer GFP miR primer (GCTGGAGTTCGTGACCGCC) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lentiviral vector that constitutively expresses puromycin-resistance and GFP driven by the CAGGS promoter.
See FLIP vector protocols (PDF from this page) for more information.
Firefly hairpin sequence is -
AAGGTATATTGCTGTTGACAGTGAGCGAGCTCCCGTGAATTGGAATCCTA
GTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCCTGCCTACTGCC
TCG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLB2 CAG P2Gm was a gift from Richard Hynes (Addgene plasmid # 19752 ; http://n2t.net/addgene:19752 ; RRID:Addgene_19752) -
For your References section:
A system for Cre-regulated RNA interference in vivo. Stern P, Astrof S, Erkeland SJ, Schustak J, Sharp PA, Hynes RO. Proc Natl Acad Sci U S A. 2008 Sep 16. 105(37):13895-900. 10.1073/pnas.0806907105 PubMed 18779577