Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#2
(Plasmid #197425)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197425 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (Addgene #48138)
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size w/o insert (bp) 9288
  • Total vector size (bp) 9291
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MAPRE1 gRNA #2 (targets Exon 5) for π-element knock-in
  • Alt name
    EB1
  • gRNA/shRNA sequence
    CCAGCATGTCATGTCGACTT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_012325.2
  • Entrez Gene
    MAPRE1 (a.k.a. EB1)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#2 was a gift from Torsten Wittmann (Addgene plasmid # 197425 ; http://n2t.net/addgene:197425 ; RRID:Addgene_197425)
  • For your References section:

    Growth cone advance requires EB1 as revealed by genomic replacement with a light-sensitive variant. Dema A, Charafeddine R, Rahgozar S, van Haren J, Wittmann T. Elife. 2023 Jan 30;12:e84143. doi: 10.7554/eLife.84143. 10.7554/eLife.84143 PubMed 36715499