pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#1
(Plasmid
#197424)
-
Purposeπ-element knock-in into exon 5 of MAPRE1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (Addgene #48138)
-
Backbone manufacturerFeng Zhang Lab
- Backbone size w/o insert (bp) 9288
- Total vector size (bp) 9291
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAPRE1 gRNA #1 (targets Exon 5) for π-element knock-in
-
Alt nameEB1
-
gRNA/shRNA sequenceCCAGCATGTCATGTCGACTT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_012325.2
-
Entrez GeneMAPRE1 (a.k.a. EB1)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.09.22.509085v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#1 was a gift from Torsten Wittmann (Addgene plasmid # 197424 ; http://n2t.net/addgene:197424 ; RRID:Addgene_197424) -
For your References section:
Growth cone advance requires EB1 as revealed by genomic replacement with a light-sensitive variant. Dema A, Charafeddine R, Rahgozar S, van Haren J, Wittmann T. Elife. 2023 Jan 30;12:e84143. doi: 10.7554/eLife.84143. 10.7554/eLife.84143 PubMed 36715499