pBridge-tyrosinase.σ1A
(Plasmid #197381)

• Purpose: Expression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-1 σ1A fusion protein in yeast (yeast three-hybrid assays)
• Depositing Lab: Juan Bonifacino
• Publication: Mattera et al J Biol Chem. 2011 Jan 21;286(3):2022-30. doi: 10.1074/jbc.M110.197178. Epub 2010 Nov 19.

Backbone

• Vector backbone: pBridge
• Backbone size w/o insert (bp): 6526
• Total vector size (bp): 7457
• Vector type: Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: tyrosinase cytosolic tail
• Species: M. musculus (mouse)
• Insert Size (bp): 428
• Mutation: silent substitution in codon 2 of tyrosinase tail (encoding residue 500 of full length protein); insert contains 317 nucleotides of 3' UTR
• Promoter: ADH1
• Tag / Fusion Protein:
  • GAL4-DNA binding domain fragment (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: GAL4 DNA binding domain (BD) forward
• 3′ sequencing primer: GAL4 DNA binding domain (BD) reverse

Gene/Insert 2

• Gene/Insert name: AP-1 σ1A
• Species: H. sapiens (human)
• Insert Size (bp): 519
• Mutation: Contains an extra 42 nucleotides encoding 14 residues before start of AP-1 σ1A ORF; the AP-1 σ1A ORF contains Q11R mutation
• Promoter: MET25
• Tags / Fusion Proteins:
  • HA tag (N terminal on backbone)
  • SV40 nuclear localization signal (NLS) (N terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: 5' gatacaattctattacccccatcc (MCS2F)
• 3′ sequencing primer: 5' gcaacacctggcaattccttacc (MCS2R)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To test interaction of novel sorting signals with AP-1 subunits, excise tyrosinase tail insert from this construct with BamH1/PstI and subclone BamH1/PstI DNA fragment encoding novel signal in MCS1. Do not use other restriction sites in MCS1 as they may be also present in insert subcloned in MCS2.